۰۲۱ - ۵ ۵ ۴ ۳ ۵ ۵ ۴ ۶ ارسال کالا به سراسر کشور
ثبت نام / ورود
سبد خرید
 فروشنده: سیگما آلدریچ

 
قیمت سیگما آلدریچ:
- تومان
 
هزینه حمل به ایران:
- تومان
 
بسته بندی و کارمزد:
- تومان
 
هزینه ی گمرک:
- تومان
 قیمت نهایی: -تومان
MISSION® 3′UTR Lenti GoClone™
Product ID: HUTR09929
Powered by SwitchGear Genomics™, 3′UTR, human, FOXN4
وارد کننده: آزمیلکس
گارانتی اصالت و سلامت کالا
پشتیبانی ۷ روز هفته ۲۴ ساعته
 NACRES NA.51
product line MISSION®
storage temp. −70°C
description Functional Validation of miRNA Gene Targets
shipped in dry ice
Quality Level 200
NCBI accession no. NM_213596
human 3′UTR sequence AACAAGCCTATAGCCCTGCTTTGAGCTGTCAGCCTCACCTGCCCTGGAACCCCGGCACCCGGCTTGGGCAGAGAACTGACTAGAACAGGGTGTTCCCAGAAGGCAGGTCCCTCATTGTCCCCGAAGCCTCTCCTGGACCTGTGGCGAAGTTGCCGGCTGGACAGGGAAGCGGTTCCCCTCAGCAGCCCCTCTCCTTCTCGTGCCTCCCCCTGGAGCTTCCGGAGCAGTTTCTGGGGGCTCTTCCAAGTCAGAAGA (3′UTR sequences are truncated after the first 255 bases)
Gene Information human ... FOXN4(121643)
محصولات مرتبط

:

MISSION® 3′UTR Lenti GoClone™
۱۷,۵۹۳,۵۰۰ تومان
MISSION® 3′UTR Lenti GoClone™
۱۷,۵۹۳,۵۰۰ تومان
MISSION® 3′UTR Lenti GoClone™
۱۷,۵۹۳,۵۰۰ تومان
MISSION® 3′UTR Lenti GoClone™
۱۷,۵۹۳,۵۰۰ تومان
MISSION® 3′UTR Lenti GoClone™
۱۷,۵۹۳,۵۰۰ تومان
MISSION® 3′UTR Lenti GoClone™
۱۷,۵۹۳,۵۰۰ تومان
MISSION® 3′UTR Lenti GoClone™
۱۷,۵۹۳,۵۰۰ تومان
MISSION® 3′UTR Lenti GoClone™
۱۷,۵۹۳,۵۰۰ تومان
MISSION® 3′UTR Lenti GoClone™
۱۷,۵۹۳,۵۰۰ تومان
MISSION® 3′UTR Lenti GoClone™
۱۷,۵۹۳,۵۰۰ تومان
MISSION® 3′UTR Lenti GoClone™
۱۷,۵۹۳,۵۰۰ تومان
MISSION® 3′UTR Lenti GoClone™
۱۷,۵۹۳,۵۰۰ تومان
MISSION® 3′UTR Lenti GoClone™
۱۷,۵۹۳,۵۰۰ تومان
MISSION® 3′UTR Lenti GoClone™
۱۷,۵۹۳,۵۰۰ تومان
MISSION® 3′UTR Lenti GoClone™
۱۷,۵۹۳,۵۰۰ تومان
MISSION® 3′UTR Lenti GoClone™
۱۷,۵۹۳,۵۰۰ تومان