۰۲۱ - ۵ ۵ ۴ ۳ ۵ ۵ ۴ ۶ ارسال کالا به سراسر کشور
ثبت نام / ورود
سبد خرید
 فروشنده: سیگما آلدریچ

 
قیمت سیگما آلدریچ:
- تومان
 
هزینه حمل به ایران:
- تومان
 
بسته بندی و کارمزد:
- تومان
 
هزینه ی گمرک:
- تومان
 قیمت نهایی: -تومان
MISSION® Lenti microRNA, Mouse
Product ID: MLMIR0355
mmu-miR-224-5p
وارد کننده: آزمیلکس
گارانتی اصالت و سلامت کالا
پشتیبانی ۷ روز هفته ۲۴ ساعته
 NACRES NA.51
mature sequence UAAGUCACUAGUGGUUCCGUU
storage temp. −70°C
product line MISSION®
shipped in dry ice
Quality Level 200
Sanger microRNA accession no. MI0000711
Sanger mature/minor accession no. MIMAT0000671
محصولات مرتبط

:

MISSION® Lenti microRNA, Mouse
۲۷,۶۹۸,۹۴۰ تومان
MISSION® Lenti microRNA, Mouse
۲۷,۶۹۸,۹۴۰ تومان
MISSION® Lenti microRNA, Mouse
۲۷,۶۹۸,۹۴۰ تومان
MISSION® Lenti microRNA, Mouse
۲۷,۶۹۸,۹۴۰ تومان
MISSION® Lenti microRNA, Mouse
۲۷,۶۹۸,۹۴۰ تومان
MISSION® Lenti microRNA, Mouse
۲۷,۶۹۸,۹۴۰ تومان
MISSION® Lenti microRNA, Mouse
۲۷,۶۹۸,۹۴۰ تومان
MISSION® Lenti microRNA, Mouse
۲۷,۶۹۸,۹۴۰ تومان
MISSION® Lenti microRNA, Mouse
۲۷,۶۹۸,۹۴۰ تومان
MISSION® Lenti microRNA, Mouse
۲۷,۶۹۸,۹۴۰ تومان
MISSION® Lenti microRNA, Mouse
۲۷,۶۹۸,۹۴۰ تومان
MISSION® Lenti microRNA, Mouse
۲۷,۶۹۸,۹۴۰ تومان
MISSION® Lenti microRNA, Mouse
۲۷,۶۹۸,۹۴۰ تومان
MISSION® Lenti microRNA, Mouse
۲۷,۶۹۸,۹۴۰ تومان
MISSION® Lenti microRNA, Mouse
۲۷,۶۹۸,۹۴۰ تومان
MISSION® Lenti microRNA, Mouse
۲۷,۶۹۸,۹۴۰ تومان