۰۲۱ - ۵ ۵ ۴ ۳ ۵ ۵ ۴ ۶ ارسال کالا به سراسر کشور
ثبت نام / ورود
سبد خرید
 فروشنده: سیگما آلدریچ

 
قیمت سیگما آلدریچ:
- تومان
 
هزینه حمل به ایران:
- تومان
 
بسته بندی و کارمزد:
- تومان
 
هزینه ی گمرک:
- تومان
 قیمت نهایی: -تومان
MISSION® Lenti microRNA Inhibitor, Mouse
Product ID: MLTUD0512
mmu-miR-494-3p
وارد کننده: آزمیلکس
گارانتی اصالت و سلامت کالا
پشتیبانی ۷ روز هفته ۲۴ ساعته
 NACRES NA.51
mature sequence UGAAACAUACACGGGAAACCUC
storage temp. −70°C
product line MISSION®
shipped in dry ice
Quality Level 200
microRNA accession no. MI0003532
Sanger mature/minor accession no. MIMAT0003182
محصولات مرتبط

:

MISSION® Lenti microRNA Inhibitor, Mouse
۲۹,۱۸۰,۷۹۰ تومان
MISSION® Lenti microRNA Inhibitor, Mouse
۲۹,۱۸۰,۷۹۰ تومان
MISSION® Lenti microRNA Inhibitor, Mouse
۲۹,۱۸۰,۷۹۰ تومان
MISSION® Lenti microRNA Inhibitor, Mouse
۲۹,۱۸۰,۷۹۰ تومان
MISSION® Lenti microRNA Inhibitor, Mouse
۲۹,۱۸۰,۷۹۰ تومان
MISSION® Lenti microRNA Inhibitor, Mouse
۲۹,۱۸۰,۷۹۰ تومان
MISSION® Lenti microRNA Inhibitor, Mouse
۲۹,۱۸۰,۷۹۰ تومان
MISSION® Lenti microRNA Inhibitor, Mouse
۲۹,۱۸۰,۷۹۰ تومان
MISSION® Lenti microRNA Inhibitor, Mouse
۲۹,۱۸۰,۷۹۰ تومان
MISSION® Lenti microRNA Inhibitor, Mouse
۲۹,۱۸۰,۷۹۰ تومان
MISSION® Lenti microRNA Inhibitor, Mouse
۲۹,۱۸۰,۷۹۰ تومان
MISSION® Lenti microRNA Inhibitor, Mouse
۲۹,۱۸۰,۷۹۰ تومان
MISSION® Lenti microRNA Inhibitor, Mouse
۲۹,۱۸۰,۷۹۰ تومان
MISSION® Lenti microRNA Inhibitor, Mouse
۲۹,۱۸۰,۷۹۰ تومان
MISSION® Lenti microRNA Inhibitor, Mouse
۲۹,۱۸۰,۷۹۰ تومان
MISSION® Lenti microRNA Inhibitor, Mouse
۲۹,۱۸۰,۷۹۰ تومان