۰۲۱ - ۵ ۵ ۴ ۳ ۵ ۵ ۴ ۶ ارسال کالا به سراسر کشور
ثبت نام / ورود
سبد خرید
 فروشنده: سیگما آلدریچ

 
قیمت سیگما آلدریچ:
- تومان
 
هزینه حمل به ایران:
- تومان
 
بسته بندی و کارمزد:
- تومان
 
هزینه ی گمرک:
- تومان
 قیمت نهایی: -تومان
MISSION® Synthetic microRNA Inhibitor, Human
Product ID: HSTUD2062
hsa-miR-4666b
وارد کننده: آزمیلکس
گارانتی اصالت و سلامت کالا
پشتیبانی ۷ روز هفته ۲۴ ساعته
 NACRES NA.51
mature sequence UUGCAUGUCAGAUUGUAAUUCCC
product line MISSION®
storage temp. −20°C
Quality Level 100
Sanger microRNA accession no. MI0019299
Sanger mature/minor accession no. MIMAT0022485
محصولات مرتبط

: