۰۲۱ - ۵ ۵ ۴ ۳ ۵ ۵ ۴ ۶ ارسال کالا به سراسر کشور
ثبت نام / ورود
سبد خرید
 فروشنده: سیگما آلدریچ

 
قیمت سیگما آلدریچ:
- تومان
 
هزینه حمل به ایران:
- تومان
 
بسته بندی و کارمزد:
- تومان
 
هزینه ی گمرک:
- تومان
 قیمت نهایی: -تومان
MISSION® esiRNA
Product ID: EMU217171
esiRNA targeting mouse Ano8
وارد کننده: آزمیلکس
گارانتی اصالت و سلامت کالا
پشتیبانی ۷ روز هفته ۲۴ ساعته
concentration 200 ng/μL RNA
shipped in dry ice
product line MISSION®
NCBI accession no. NM_001164679
description Powered by Eupheria Biotech
Ensembl | mouse accession no. ENSMUSG00000034863
Gene Information mouse ... Ano8(382014)
Quality Level 100
esiRNA cDNA target sequence TCCTGCGAAGAGGACTTCATCTACGAGAATGTGGAGAGCGAGCTACGCTTCTTCACATCGCAGGAGCGGCAGAGCATCATTCGCTTCTGGTTGCAGAACCTTCGAGCCAAGCAGGGGGAGGCTCTGCACAACGTGCGCTTCTTGGAGGACCAGCCAATCACAGTTCCGGAGCTGGCTGCACGAGGCATCATACAGCAGGTGTTTCCAGTTCACGAGCAGCGTATTCTGAATCGTCTCATGAAGTCCTGGGTGCAGGCCGTGTGTGAAAACCAGCCTTTAGATGATATCTGTGACTATTTTGGGGTGAAGATTGCCATGTATTTTGCCTGGCTGGGCTTCTACACATCGGCAATGGTTTATCCTGCAGTTTTTGGCTCTGTTCTGTATACATTCACTGAGGCTGATCAGACAAGCCGGGATGTTTCCTGTGTGGTCTTCGCTCTCTTCAATGTGATCTGGTCAACACTGTTCTTGGAGGAGTGGAAA
storage temp. −20°C
محصولات مرتبط

:

MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۷۱۴,۵۰۰ تومان