۰۲۱ - ۵ ۵ ۴ ۳ ۵ ۵ ۴ ۶ ارسال کالا به سراسر کشور
ثبت نام / ورود
سبد خرید
 فروشنده: سیگما آلدریچ

 
قیمت سیگما آلدریچ:
- تومان
 
هزینه حمل به ایران:
- تومان
 
بسته بندی و کارمزد:
- تومان
 
هزینه ی گمرک:
- تومان
 قیمت نهایی: -تومان
MISSION® esiRNA
Product ID: EMU010321
esiRNA targeting mouse Armcx1 (esiRNA1)
وارد کننده: آزمیلکس
گارانتی اصالت و سلامت کالا
پشتیبانی ۷ روز هفته ۲۴ ساعته
 NACRES NA.51
product line MISSION®
NCBI accession no. NP_084342
description Powered by Eupheria Biotech
Ensembl | mouse accession no. ENSMUSG00000033460
Gene Information mouse ... Armcx1(78248)
Quality Level 100
esiRNA cDNA target sequence TTCTGAGAATCAGGGCAAGATTAAGACTTATATCAGTCAAGTGTGTGACGATACCATGGTTTGCCGCTTGGACTCAGCCGTCCAGATGGCTGGATTAAGACTCCTTACCAACATGACTGTAACTAATCACTACCAACATTTGCTTTCCTATTCTTTCCCAGATTTCTTTGCTTTGTTATTCCTGGGAAACCACTTCACCAAGATACAGACTATGAAACTGATTATAAATTTTACTGAAAACCCAGCCATGACAAGAGAGCTGGTCAGTTGTAAAGTACCTTCGGAATTGATTTCTCTGTTTAATAAAGAATGGGATAGAGAGATTCTTCTTAACATTCTTACCCTCTTTGAAAATATAAACGATAACATAAAAAGTGAAGGGCTTGCATCCTCCAGGAAGGAATTCAGCAGGAGCTCA
storage temp. −20°C
concentration 200 ng/μL RNA
shipped in dry ice
محصولات مرتبط

:

MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان
MISSION® esiRNA
۷,۹۳۶,۵۰۰ تومان